View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5706_high_36 (Length: 286)
Name: NF5706_high_36
Description: NF5706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5706_high_36 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 129; Significance: 8e-67; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 13 - 270
Target Start/End: Complemental strand, 7497814 - 7497556
Alignment:
| Q |
13 |
tgagatttttggttgaaaagctgtttaatatagtaga--taataaggagtggtcccttatcttaaggattttagtcctccannnnnnngttgtcttacat |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
7497814 |
tgagatttttggttgaaaagctgtttaatatagtagagataataagaagtggtcccttattataaggattttagtcctccatttttt-gttgtcttacat |
7497716 |
T |
|
| Q |
111 |
gaagtggtaaagactatatgaannnnnnnnnnnnnnnnnnnnnnattgcacaactgtaaggtccttaattcgaattcaggtgaaggtgtctagcctcaaa |
210 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7497715 |
gaagtggtaaagactatatgaaacacacacaactcacacacacaattgcacaactgtaaggtccttaattcgaactcaggtgaaggtgtctagcctcaaa |
7497616 |
T |
|
| Q |
211 |
atagtgatcttagactttaaggactagtcctcataaggtcctgaattcgaactcatgtga |
270 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||| |||||||||||||||||||||| |
|
|
| T |
7497615 |
atagtgatcttagactttaaggactggtccttataagatcctgaattcgaactcatgtga |
7497556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 194 - 241
Target Start/End: Complemental strand, 7497547 - 7497500
Alignment:
| Q |
194 |
aggtgtctagcctcaaaatagtgatcttagactttaaggactagtcct |
241 |
Q |
| |
|
||||||||||||| | ||||||||||| || ||||||||||||||||| |
|
|
| T |
7497547 |
aggtgtctagcctaagaatagtgatctcaggctttaaggactagtcct |
7497500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University