View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5706_high_48 (Length: 250)
Name: NF5706_high_48
Description: NF5706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5706_high_48 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 41008587 - 41008823
Alignment:
| Q |
1 |
taatatctgctaaacgtgtaaactttatcagacaccataaataggctgacacacctcctaatggatgatagctttaacatgtcctggaaggttgcttatn |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41008587 |
taatatctgctaaacgagtaaactttatcagacaccataaataggctgacacacctcctaatggatgatagctttaacatgtcctggaaggttgcttata |
41008686 |
T |
 |
| Q |
101 |
nnnnnnntgcgctggaaggtagtgaaccaattgaataggtttctaattttctagcaagaaccgacccatatcattcatagaccaaaatccgagtaaatca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41008687 |
aaaaaaatgcgctggaaggtagtgaaccaattgaataggtttctaattttctagcaagaaccgatccatatcattcatagaccaaaatccgagtaaatca |
41008786 |
T |
 |
| Q |
201 |
ttaaattggtcaccgtaagtcattctccaactagtct |
237 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
41008787 |
ttaaagtggtcaccgtaagtcattctcaaactagtct |
41008823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University