View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5706_high_50 (Length: 245)
Name: NF5706_high_50
Description: NF5706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5706_high_50 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 63 - 226
Target Start/End: Complemental strand, 13277381 - 13277218
Alignment:
| Q |
63 |
cttagcttatgaaggtactgcgttgccgttgcgtgtgtcacagtggttgtcgtcttcaccgttgtggctgttgtctccaatctccaccatcgtcgttgcg |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13277381 |
cttagcttatgaaggtactgcgttgccgttgtgtgtgtcacagtggttgtcgtcttcaccgttgtggctgttgtctccaatctccaccatcgtcgttgcg |
13277282 |
T |
 |
| Q |
163 |
ttgccgtatccgtttctctgtctgttgccattgttgcagagttcgtgcaaatggataccgagaa |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
13277281 |
ttgccgtatccgtttctctgtctgttgccattgttgcagagttcgtgcaaatggatacggagaa |
13277218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University