View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5706_high_51 (Length: 243)
Name: NF5706_high_51
Description: NF5706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5706_high_51 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 8 - 239
Target Start/End: Complemental strand, 14347516 - 14347285
Alignment:
| Q |
8 |
tttgttccttaaagtctcaatgctaacatccttttgaataattgcatgcccaagatgatgaaccatggcaatagacctcagattgtgagaagttagtgct |
107 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14347516 |
tttgttctttaaagtgtcaatgctaacatccttttgaataattgcatgcccaagatgatgaaccatggcaatagacctcagattgtgagaagttagtgct |
14347417 |
T |
 |
| Q |
108 |
ttgcaaacaccaatatccccagctctagcaaattttgcttcgtcagttggacgcattatatgctcatctacgatgttagatcgatcgatggacaaattcc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
14347416 |
ttgcaaacaccaatatccccagctctagcaaattttgcttcgtcagttggacgcattatatgctcatctatgatgttagatcgatcgatggacaaattcc |
14347317 |
T |
 |
| Q |
208 |
ataatgagtcctcacctttgtcaaactcccta |
239 |
Q |
| |
|
| |||||||||||||||||||||||||||||| |
|
|
| T |
14347316 |
acaatgagtcctcacctttgtcaaactcccta |
14347285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University