View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5706_high_53 (Length: 240)
Name: NF5706_high_53
Description: NF5706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5706_high_53 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 15 - 221
Target Start/End: Complemental strand, 13202562 - 13202354
Alignment:
| Q |
15 |
atgaacaaaattaaaatataatatttttattccttgtgatggnnnnnnnnnnnnnnnntaatcataatcta--gttttatttatttagactgaacaattt |
112 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| ||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
13202562 |
atgaacaagattaaaatataatatttttattccttgtgatggaaaaagaaaagaaaaataatcataatctatagttttaattatttagactgaacaattt |
13202463 |
T |
|
| Q |
113 |
aattaatttagttgagatttatagactcaccatccctcaaggaatccagtactttgtcttctgggtggtggagcagcatattgaggtggtgccatcactg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13202462 |
aattaatttagttgagatttatagactcaccatccctcaaggaatccagtactttgtcttctgggtggtggagcagcatattgaggtggtgccatcactg |
13202363 |
T |
|
| Q |
213 |
ggggacctt |
221 |
Q |
| |
|
||||||||| |
|
|
| T |
13202362 |
ggggacctt |
13202354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University