View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5706_high_8 (Length: 516)
Name: NF5706_high_8
Description: NF5706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5706_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 466; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 466; E-Value: 0
Query Start/End: Original strand, 16 - 497
Target Start/End: Original strand, 47053663 - 47054144
Alignment:
| Q |
16 |
atcacaactgaaacaaagagagaaagggagcaaaggcaaagagacacacgagccaagctggaagagcacacactcttctctaagaagaaactaaacccta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47053663 |
atcacaactgaaacaaagagagaaagggagcaaaggcaaagagacacacgagccaagctggaagagcacacactcttctctaagaagaaactaaacccta |
47053762 |
T |
 |
| Q |
116 |
atagagcttagggaacttagacgacgctgagttatgaaattctaagtttctaaccaatgttatcttctgagaaacaatcactaagctttctccaaacatt |
215 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47053763 |
acagagcttagggaacttagacgacgctgagttatgaaattctaagtttctaaccaatgttatcttctgagaaacaatcactaagctttctccaaacatt |
47053862 |
T |
 |
| Q |
216 |
ggcagcttcatcagtctacaaaatgcttgtggcagcgctagctgacatgcaatgaccgactcacaaaagcaccaacaggtttcatcttttccatttgtcc |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47053863 |
ggcagcttcatcagtctacaaaatgcttgtggcagcgctagctgacacgcaatgaccgactcacaaaagcaccaacaggtttcatcttttccatttgtcc |
47053962 |
T |
 |
| Q |
316 |
aaggtagaggcatcatagtaaagttcctaaatagtttatttctactttatagggacatagtcatggcacatgatcaacactaaaaattttaaccttgaag |
415 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
47053963 |
aaggtagaggcatcatagtaaagttcctaaatagattatttctactttatagggacatagtcatggcacatgatcaacactaaaatttttaaccttgaag |
47054062 |
T |
 |
| Q |
416 |
cattggaaagtaattaggagggaatggttttcatctgggtgagaatgtagagaagaaaggggacgaaggtgatagaagtaga |
497 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47054063 |
cattggaaagtaattaggagggaatggttttcatctgggtgagaatgtagagaagaaaggggacgaaggtgatagaagtaga |
47054144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University