View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5706_low_35 (Length: 309)
Name: NF5706_low_35
Description: NF5706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5706_low_35 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 293
Target Start/End: Complemental strand, 25035529 - 25035227
Alignment:
| Q |
1 |
tatgtacctcgcataatggaattaggtagattaatgaatagaacatatatccagacttgtatatgatcatagcaccgacacctcggattgaaggagtgtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
25035529 |
tatgtacctcgcataatggaattaggtagattaatgaatagaacatatatccagacttgtatacgatcatagcaccgacacctcggattgaaggagtgtt |
25035430 |
T |
 |
| Q |
101 |
tggtatccggcacgtgtcagtgaccgacattagcacaattggttacattgagtcact----------tatattattatagatatgttttagtattggtgt |
190 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |||| |||| |
|
|
| T |
25035429 |
tggtatccggcacgtgtcagtgatcgacattaacacaattggttacattgagtcacttataatttcttatattattatagatatgtttcggtatctgtgt |
25035330 |
T |
 |
| Q |
191 |
cgagtctgatgtccatgtctatgttttgtactaagaaattagtgatatggactttggtttctgctcattcaaatgcaatctaggaaacattacttattgc |
290 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| || ||| |
|
|
| T |
25035329 |
cgagtctgatgtccacgtctatgttttgtactaagaaattagcgatatggactttggcttctgctcattcaaatgcaatctaggaaacattacataatgc |
25035230 |
T |
 |
| Q |
291 |
aca |
293 |
Q |
| |
|
||| |
|
|
| T |
25035229 |
aca |
25035227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University