View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5706_low_53 (Length: 249)
Name: NF5706_low_53
Description: NF5706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5706_low_53 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 10 - 91
Target Start/End: Complemental strand, 2245520 - 2245439
Alignment:
| Q |
10 |
aagaagcaagtaaataatattcacacgcatttgaccagtactactcaatttagctcaacaataacaatcatgtacaattact |
91 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2245520 |
aagaagcaagtaaataatattcacacgcatttgactagtactactcaatttagctcaacaataacaatcatgtacaattact |
2245439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 149 - 249
Target Start/End: Complemental strand, 2245381 - 2245287
Alignment:
| Q |
149 |
ccatatggttttagattctgccttaattgacatatatataatatactgtacnnnnnnngttttcattccagaaaaccagaaaatccgttgtgaacattat |
248 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| |||| | |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2245381 |
ccatatggttttagattctgccttaattggcatatatata---tacttt---ttttttgttttcattccagaaaaccagaaaatccgttgtgaacattat |
2245288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University