View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5706_low_54 (Length: 245)

Name: NF5706_low_54
Description: NF5706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5706_low_54
NF5706_low_54
[»] chr5 (1 HSPs)
chr5 (63-226)||(13277218-13277381)


Alignment Details
Target: chr5 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 63 - 226
Target Start/End: Complemental strand, 13277381 - 13277218
Alignment:
63 cttagcttatgaaggtactgcgttgccgttgcgtgtgtcacagtggttgtcgtcttcaccgttgtggctgttgtctccaatctccaccatcgtcgttgcg 162  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13277381 cttagcttatgaaggtactgcgttgccgttgtgtgtgtcacagtggttgtcgtcttcaccgttgtggctgttgtctccaatctccaccatcgtcgttgcg 13277282  T
163 ttgccgtatccgtttctctgtctgttgccattgttgcagagttcgtgcaaatggataccgagaa 226  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
13277281 ttgccgtatccgtttctctgtctgttgccattgttgcagagttcgtgcaaatggatacggagaa 13277218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University