View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5706_low_59 (Length: 239)
Name: NF5706_low_59
Description: NF5706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5706_low_59 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 31851327 - 31851565
Alignment:
| Q |
1 |
cttctcagcagatttatcaaatgctagcttcttagctgtcttgtctagtgcactcacaatgttgttcttccctgcaaaagcaagcttcttattcttttgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
31851327 |
cttctcagcagatttatcaaatgctagcttcttagctgtcttgtctagtgcactcacaatgttgttcttccctgcaaaagcaagcttcttgttcctttgt |
31851426 |
T |
|
| Q |
101 |
gcattaacctcaaagcaaactatcttgaggttattgttcttggaagctatggttacaaaaggatgaccagctgggacaacaaacactgttcctgacctta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31851427 |
gcattaacctcaaagcaaactatcttgaggttattgttcttggaagctatggttacaaaaggatgaccagctgggacaacaaacactgttcctggcctta |
31851526 |
T |
|
| Q |
201 |
atcttgcattgattttttggtatgaagtgctgctactcc |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31851527 |
atcttgcattgattttttggtatgaagtgctgctactcc |
31851565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University