View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5706_low_65 (Length: 231)
Name: NF5706_low_65
Description: NF5706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5706_low_65 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 11 - 212
Target Start/End: Original strand, 38353839 - 38354040
Alignment:
| Q |
11 |
gaagaatatacagagaaaagtttacttggaagaataaaatcagctgcaatgtggtctagaactgaaagtacacttccatatagagatcaccctacttttg |
110 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38353839 |
gaagaaaatacagagaaaagtttacttggaagaataaaatcagctgcaatgtggtctagaactgaaagtacacttccatatagagatcaccctacttttg |
38353938 |
T |
|
| Q |
111 |
aagaaattagaatgttcagttataattctaaggcgtctacaagtggctcaagttcaattttaccgtcggattcagatatcattcgggaaggccggtaatg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38353939 |
aagaaattagaatgttcagttataattctaagacatctacaagtggctcaagttcaattttaccgtcggattcagatatcattcgggaaggccggtaatg |
38354038 |
T |
|
| Q |
211 |
tt |
212 |
Q |
| |
|
|| |
|
|
| T |
38354039 |
tt |
38354040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 23 - 138
Target Start/End: Complemental strand, 38542959 - 38542853
Alignment:
| Q |
23 |
gagaaaagtttacttggaagaataaaatcagctgcaatgtggtctagaactgaaagtacacttccatatagagatcaccctacttttgaagaaattagaa |
122 |
Q |
| |
|
|||| |||||| ||| |||||||| |||||||||||| |||||||||||||| ||| | |||| ||| ||||| |||||||||||||||| |
|
|
| T |
38542959 |
gagacaagtttgcttagaagaatacaatcagctgcaacatggtctagaactga---------tccgtgcagaggtcatcctacctttgaagaaattagaa |
38542869 |
T |
|
| Q |
123 |
tgttcagttataattc |
138 |
Q |
| |
|
|| ||||||||||||| |
|
|
| T |
38542868 |
tgatcagttataattc |
38542853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University