View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5706_low_69 (Length: 205)
Name: NF5706_low_69
Description: NF5706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5706_low_69 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 71; Significance: 2e-32; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 70 - 184
Target Start/End: Original strand, 21429475 - 21429591
Alignment:
| Q |
70 |
ttttatgtctgtagtagaaaagag--aaagtgatggtaaagtgtagaatgagaccaagtc-aaggggcaagagaatggtcaggtgttttgttttgtttat |
166 |
Q |
| |
|
||||||||||||||| ||| |||| |||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
21429475 |
ttttatgtctgtagtggaacagagagaaagtgatggtaaagtgtagaatgtgaccaagtcaaaggggcaagagaatggtcaggtgtttt-ttttatttat |
21429573 |
T |
|
| Q |
167 |
ttaataatgtatatgcat |
184 |
Q |
| |
|
| |||||||||||||||| |
|
|
| T |
21429574 |
tcaataatgtatatgcat |
21429591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 20 - 53
Target Start/End: Original strand, 21429421 - 21429454
Alignment:
| Q |
20 |
tcaacatgacagggttattgttgtgggatttgag |
53 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
21429421 |
tcaacatgacagggttgttgttgtgggatttgag |
21429454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University