View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5708-Insertion-4 (Length: 473)
Name: NF5708-Insertion-4
Description: NF5708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5708-Insertion-4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 100; Significance: 3e-49; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 169 - 332
Target Start/End: Complemental strand, 23918393 - 23918231
Alignment:
| Q |
169 |
tcgattcccagaagctaggaatagcagcttctgtgaaaatagcttcagcatggtcaaaagcacggcagcggcatgagggtgaaagataaccaaacatcac |
268 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
23918393 |
tcgattcctagaagctaggaatagcagcttctgtgaaaatagcttcagcctggtcaaaagcacagcagcaacataagggtgaaagataaccaaacatcac |
23918294 |
T |
|
| Q |
269 |
aaaattgattttgacatgatgaaccgtgcgtttgcactttttcaccgggtaaccaaacacccac |
332 |
Q |
| |
|
|||||| |||||| | |||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
23918293 |
aaaattacttttgagaagatgaa-agtgcttttgcacttttctaccgggtaaccaaacacccac |
23918231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 222 - 332
Target Start/End: Original strand, 10854014 - 10854123
Alignment:
| Q |
222 |
tcaaaagcacggcagcggcatgagggtgaaagataaccaaacatcacaaaattgattttgacatgatgaaccgtgcgtttgcactttttcaccgggtaac |
321 |
Q |
| |
|
||||||||||| || | ||| |||||||||||||||||||||| | ||||||| |||||| | ||||| ||||| ||||||| |||||| |||||||| |
|
|
| T |
10854014 |
tcaaaagcacgacaacaacataagggtgaaagataaccaaacattataaaattgcttttgagaaaatgaa-cgtgcttttgcaccttttcatcgggtaac |
10854112 |
T |
|
| Q |
322 |
caaacacccac |
332 |
Q |
| |
|
||||||||||| |
|
|
| T |
10854113 |
caaacacccac |
10854123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 11 - 57
Target Start/End: Complemental strand, 23918625 - 23918579
Alignment:
| Q |
11 |
atgatgttatgatttaggtgaggaaacaaatttgtcttcaatgtttg |
57 |
Q |
| |
|
|||| |||||||||||||||| ||||||| |||||||||||| |||| |
|
|
| T |
23918625 |
atgaagttatgatttaggtgaagaaacaactttgtcttcaatttttg |
23918579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 17 - 58
Target Start/End: Complemental strand, 7009076 - 7009035
Alignment:
| Q |
17 |
ttatgatttaggtgaggaaacaaatttgtcttcaatgtttga |
58 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
7009076 |
ttatgatttaggtgaagaaacatctttgtcttcaatgtttga |
7009035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 86; Significance: 6e-41; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 86; E-Value: 6e-41
Query Start/End: Original strand, 334 - 459
Target Start/End: Original strand, 42032243 - 42032373
Alignment:
| Q |
334 |
tacttcactttgatatgatgaggtgttgcatccggtatgtgttt-ggaaccacgctgggttcccttcaaacgcattggaaagtgcga----ggagggact |
428 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| || | | |||| |
|
|
| T |
42032243 |
tacttcactttgatataatgaggtgttgcatccggtatgtgttttggaaccacgctgggttcccttcaaacgcattggaaagtgtgacaatcgtgagact |
42032342 |
T |
|
| Q |
429 |
tgggatgacatacgggaaaccaaacatccag |
459 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
42032343 |
tgggatgacatacgggaaaccaaacatccag |
42032373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 69; Significance: 9e-31; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 69; E-Value: 9e-31
Query Start/End: Original strand, 169 - 327
Target Start/End: Complemental strand, 37267223 - 37267081
Alignment:
| Q |
169 |
tcgattcccagaagctaggaatagcagcttctgtgaaaatagcttcagcatggtcaaaagcacggcagcggcatgagggtgaaagataaccaaacatcac |
268 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
37267223 |
tcgattcctagaagctaggaatagcagcttctgtgaaaatagcttcagcatggtcaaaagcacgacagc---------------gataaccaaacatcac |
37267139 |
T |
|
| Q |
269 |
aaaattgattttgacatgatgaaccgtgcgtttgcactttttcaccgggtaaccaaaca |
327 |
Q |
| |
|
|||||| |||||| | |||||| ||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
37267138 |
aaaattacttttgagaagatgaa-cgtgcttttgcaccttttcaccgggtaaccaaaca |
37267081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University