View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5708-Insertion-5 (Length: 278)
Name: NF5708-Insertion-5
Description: NF5708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5708-Insertion-5 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 6 - 278
Target Start/End: Complemental strand, 33429070 - 33428790
Alignment:
| Q |
6 |
catctacctatccaatgtttgattttcacattgcacaactttttacatctctgttaagccttgcagagtaggaaatagttttgcagtttgctgacaccct |
105 |
Q |
| |
|
||||| ||||| |||||| |||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
33429070 |
catctgcctattcaatgtctgattttcacattgcacaactttttacatctctgttgagtcttgcagagtaggaaatagttttgcagtttactgacaccct |
33428971 |
T |
 |
| Q |
106 |
cctgatgtgggtttctaagtggatttgtttagaa--------atgcttctctgtttactatggaactaaatacagttgtgtatgcgattgatcaatgctc |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| ||| ||||||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
33428970 |
cctgatgtgggtttctaagtggatttgtttagaacattgggcatgcttatctctttactatggaactaaatacatttgtgtatgtgattgatcaatgctc |
33428871 |
T |
 |
| Q |
198 |
gattttgaaggaccataacatttggattggtccttcaactcaaatcatgttattatttgtctctttgtaatagatggaata |
278 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
33428870 |
gattttgaaggaccataacgattggatttgtccttcaactcaaatcatgttattatttgtttcttcgtaatagatggaata |
33428790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University