View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5708_high_12 (Length: 248)
Name: NF5708_high_12
Description: NF5708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5708_high_12 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 7 - 248
Target Start/End: Complemental strand, 13969621 - 13969381
Alignment:
| Q |
7 |
gataattctcagtcctcaactccttataacatctttgctcaagatagcttgttatctgtaaaaacaaccatggccaacacagtcatttt-caaatatcag |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
13969621 |
gataattctcagtcctcaactccttataacatctttgctcaagatagcttgttatctgtaaaaacaaccatggccaacacagtcattttacaaatatcag |
13969522 |
T |
 |
| Q |
106 |
tcatatnnnnnnnnttgcccccggggctattcaacaaggagtgaaaacccaactcgattcctcacatttttctaatggcacaattcagtgcctgacaaaa |
205 |
Q |
| |
|
||||| ||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13969521 |
tcata--aaaaaaattgcccccgggtctattcgacaaggagtgaaaacccaactcgattcctcacatttttctaatggcacaattcagtgcctgacaaaa |
13969424 |
T |
 |
| Q |
206 |
attaatctcaaattagtccctgtgaggacaaattagtctctat |
248 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
13969423 |
attaatctcaaattagtccctgtgagaacaaattagtctctat |
13969381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University