View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5708_low_11 (Length: 260)
Name: NF5708_low_11
Description: NF5708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5708_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 251
Target Start/End: Complemental strand, 29650042 - 29649792
Alignment:
| Q |
1 |
caatgaaattaatcccacgagtaaactttgattcattgctctttcccaaaaacatttctcttgaagagaaacacaataaattagtccaactctcaaaaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29650042 |
caatgaaattaatcccacgagtaaactttgattcaattctctttcccaaaaacatttctcttgaagagaaacacaatagattagtccaactctcaaaaat |
29649943 |
T |
|
| Q |
101 |
tcatgctcttaagtatcaaatgaacaacaccaatgcaatatccccacaaacttttcaaccacttgtgccaactatttctaacatatatgctgttgaaatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
29649942 |
tcatgctcttaagtatcaaatgaacaacaccaatgcaatatccccacaaacttttcaaccacttgtcccaactatttctaacatatatgctgttgaaatg |
29649843 |
T |
|
| Q |
201 |
aggattggcacaccaccattcacaactttgttgatgtttgacacaggttct |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29649842 |
aggattggcacaccaccattcacaactttgttgatgtttgacacaggttct |
29649792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University