View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5709-Insertion-8 (Length: 225)
Name: NF5709-Insertion-8
Description: NF5709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5709-Insertion-8 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 9 - 225
Target Start/End: Original strand, 42209048 - 42209278
Alignment:
| Q |
9 |
tatgaccgatgcgtatagaaaaatatatgtcgggaaagagattacttgtcaaacaaatgattcaaaactccttaaggaggtatatgattatatatgagaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42209048 |
tatgaccgatgcgtatagaaaaatatatgtcgggaaagagattacttgtcaaacaaatgattcaaaactccttaaggaggtatatgattatatatgagaa |
42209147 |
T |
|
| Q |
109 |
gaggatcctctctggtgtgg---gttttacaggagagtatccaatgaacatcttcaccttttcattct------------tctaaaccctcattcttcta |
193 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
42209148 |
gaggatcctc-ctggtgtgggatgttttacaggagagtatccaatgaacatcttcaccttttcattcttctaaaccctcctctaaaccctcattcttcta |
42209246 |
T |
|
| Q |
194 |
aaccgagattagtaagaaagacctctaccgac |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
42209247 |
aaccgagattagtaagaaagacctctaccgac |
42209278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University