View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5709_high_14 (Length: 239)
Name: NF5709_high_14
Description: NF5709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5709_high_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 26509247 - 26509017
Alignment:
| Q |
1 |
acatacaatacaagttaacttatttttgtaaagatagtatacttgta--------tgagttaacttgagagtttaattagtatggatgatttcttcaact |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26509247 |
acatacaatacaagttaacttatttttgtaaagatagtatacttgtaagcttttatgagttaacttgagagtttaattagtatggatgatttcttcaact |
26509148 |
T |
 |
| Q |
93 |
agtaataacatcacgcctctgcagaaaaacaactgctcggctgaatgtttatcgtcaaatcattctctttctgtctgtgtgtgtatgagcatgtattttt |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
26509147 |
agtaataacatcacgcctctgcagaaaaacaactgctcggctgaatgtttatcgtcaaatcattctctttctgtctgt--gtgtatgagcatgtattttt |
26509050 |
T |
 |
| Q |
193 |
ccatccttttcttttaggctagacccacttgat |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
26509049 |
ccatccttttcttttaggctagacccacttgat |
26509017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University