View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5710_high_7 (Length: 281)
Name: NF5710_high_7
Description: NF5710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5710_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 17 - 265
Target Start/End: Complemental strand, 37216747 - 37216499
Alignment:
| Q |
17 |
tgggtgggtgaaagcgcagaattttcggtaagaccaggataacaatgttgagaaagaggttagtgttgattagtttactgggcattttgcgaagagtttg |
116 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37216747 |
tgggtgggtgaaagcgcggaattttcggtaagaccaggataacaatgttgagaaagaggttagtgttgattagtttactgggcattttgcaaagagtttg |
37216648 |
T |
 |
| Q |
117 |
gcaaggattctttcatgtcgtttgggacaatgcttactctcttgtccgccgaaatgacacatctctagtgttggtggatggttgagttaggagtgtctgc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
37216647 |
gcaaggattctttcatgtcgtttgggacaatgcttactctcttgtccgccgaaatgacacatccctagtgttggtagatggttgagttaggagcgtctgc |
37216548 |
T |
 |
| Q |
217 |
aagatcccaatgttggaagtgcatgtattgttttttcttctgttgtgca |
265 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
37216547 |
aagatcccaatgttggaagtgtgtgtattgttttttcttctgctgtgca |
37216499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University