View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5712-Insertion-1 (Length: 791)
Name: NF5712-Insertion-1
Description: NF5712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5712-Insertion-1 |
 | |
|
| [»] chr7 (4 HSPs) |
| |
|
| [»] scaffold0047 (2 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 7e-79; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 7e-79
Query Start/End: Original strand, 510 - 791
Target Start/End: Original strand, 43503341 - 43503628
Alignment:
| Q |
510 |
tttcaaaattacattcagttttactcttgagtagttttgtagtcgacactatggcattttgttttggtcgttgttatgaccaagctattttttctggtag |
609 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43503341 |
tttcaaaattacattcagttttactcttgagtagttttgtagttgatactatggcattttgttttggtcgttgttatgaccaagctattttttctggtag |
43503440 |
T |
|
| Q |
610 |
atcataa-------nnnnnnnnnnnnnatctctttacatgttattcaaatacatatatcttgtgcttggatttgagttattccaatacatctttgccgat |
702 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43503441 |
atcataacttcttttttttttttttttatctctttacatgttattcaaatacatatatcttgtgcttggatttgagtttttccaatacatctttgccgat |
43503540 |
T |
|
| Q |
703 |
ttnnnnnnngatccaattcctcttgtcgaaggcacaatatatagatnnnnnnnntctacatgaaacatattatgtcagtctaatataag |
791 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||| || |||||||||||||||| ||||||||||||||| |
|
|
| T |
43503541 |
ttaaaaaaatatccaattcctcttgtcgaaggcacaatatatagat-aaataaatccacatgaaacatattatatcagtctaatataag |
43503628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 83; E-Value: 7e-39
Query Start/End: Original strand, 254 - 352
Target Start/End: Original strand, 43503084 - 43503182
Alignment:
| Q |
254 |
gtttgacacttttttccttctttgatccatattatttgaactatgcatatgattggctttatgattcaaaaacttaacttacaagcaaatgtggttcaa |
352 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
43503084 |
gtttgacacttttttccttcttttatccagattatttgaactatgcatatgattggctttatgattcaaaaacttaacttataatcaaatgtggttcaa |
43503182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 9 - 43
Target Start/End: Original strand, 43502970 - 43503004
Alignment:
| Q |
9 |
taggcacaatccttgtttattgataactcaagttt |
43 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |
|
|
| T |
43502970 |
taggcacaatgcttgtttattgataactcaagttt |
43503004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 762 - 791
Target Start/End: Original strand, 39070082 - 39070111
Alignment:
| Q |
762 |
atgaaacatattatgtcagtctaatataag |
791 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
39070082 |
atgaaacatattatgtcagtctaatataag |
39070111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0047 (Bit Score: 62; Significance: 2e-26; HSPs: 2)
Name: scaffold0047
Description:
Target: scaffold0047; HSP #1
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 233 - 354
Target Start/End: Complemental strand, 48115 - 47994
Alignment:
| Q |
233 |
acccactccactatgaggcaggtttgacacttttttccttctttgatccatattatttgaactatgcatatgattggctttatgattcaaaaacttaact |
332 |
Q |
| |
|
|||||||||||||||||| || |||||||| | | | |||||| || | ||||||||||||||||||||||||| ||||||||||||||||||||| | |
|
|
| T |
48115 |
acccactccactatgaggtagctttgacacatctctttttctttcatttagattatttgaactatgcatatgattgactttatgattcaaaaacttaatt |
48016 |
T |
|
| Q |
333 |
tacaagcaaatgtggttcaaca |
354 |
Q |
| |
|
|| || |||||||||||||||| |
|
|
| T |
48015 |
tataatcaaatgtggttcaaca |
47994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0047; HSP #2
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 558 - 614
Target Start/End: Complemental strand, 47756 - 47700
Alignment:
| Q |
558 |
ctatggcattttgttttggtcgttgttat-gaccaagctattttttctggtagatcat |
614 |
Q |
| |
|
||||| ||||||||||||||||||||||| || ||| |||||||| |||||||||||| |
|
|
| T |
47756 |
ctatgacattttgttttggtcgttgttatggatcaa-ctatttttcctggtagatcat |
47700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 51; Significance: 8e-20; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 292 - 354
Target Start/End: Complemental strand, 24576343 - 24576281
Alignment:
| Q |
292 |
aactatgcatatgattggctttatgattcaaaaacttaacttacaagcaaatgtggttcaaca |
354 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
24576343 |
aactatgcatatgattgactttatgattcaaaaacttaacttataatcaaatgtggttcaaca |
24576281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University