View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5712_low_14 (Length: 238)
Name: NF5712_low_14
Description: NF5712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5712_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 227; Significance: 1e-125; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 28080777 - 28080547
Alignment:
| Q |
1 |
ttcaagacattgccaatcttttgaccagcgatcgttacttcatatgaatgattctacaggtactatcaattttccggttgatcctctcattgatatttct |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28080777 |
ttcaagacattgccgatcttttgaccagcgatcgttacttcatatgaatgattctacaggtactatcaattttccggttgatcctctcattgatatttct |
28080678 |
T |
 |
| Q |
101 |
caacactcgaatatgatgagtattggcaacaagaatttgtatccacacttatcctatcaagggacaccaactctacaattgcatcatgtttctgattatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28080677 |
caacactcgaatatgatgagtattggcaacaagaatttgtatccacacttatcctatcaagggacaccaactctacaattgcatcatgtttctgattatg |
28080578 |
T |
 |
| Q |
201 |
cagtagataacaatgtcatcaatgatgatgt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
28080577 |
cagtagataacaatgtcatcaatgatgatgt |
28080547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 28080903 - 28080871
Alignment:
| Q |
1 |
ttcaagacattgccaatcttttgaccagcgatc |
33 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
28080903 |
ttcaagacatcgccaatcttttgaccagcgatc |
28080871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 28080966 - 28080934
Alignment:
| Q |
1 |
ttcaagacattgccaatcttttgaccagcgatc |
33 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
28080966 |
ttcaagacatcgccaatcttttgaccagcgatc |
28080934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University