View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5713-Insertion-12 (Length: 209)
Name: NF5713-Insertion-12
Description: NF5713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5713-Insertion-12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 8 - 203
Target Start/End: Complemental strand, 44908361 - 44908166
Alignment:
| Q |
8 |
cttgtatgtctctccaggcttaacaatctgagatggaaagttaggcttattcacagaatctgggtaaccttgtgtctccaaagcaatgccaccatacttg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
44908361 |
cttgtatgtctctccaggcttaacaatctgagatggaaagttaggcttattcacagaatctgggaaaccctgtgtctccaaagcaatgccaccatacttg |
44908262 |
T |
 |
| Q |
108 |
tgatatgtagctccatcctttcctttagtatcagtcaacattccactagtatagtattgcaatccaacttggtttgaccacaactccattttcctt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44908261 |
tgatatgtagctccatcctttcctttagtatcagtcaacattccactagtatagtattgcaatccaacttggtttgaccacaactccattttcctt |
44908166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University