View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5713-Insertion-13 (Length: 175)
Name: NF5713-Insertion-13
Description: NF5713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5713-Insertion-13 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 91; Significance: 2e-44; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 91; E-Value: 2e-44
Query Start/End: Original strand, 74 - 175
Target Start/End: Complemental strand, 44376295 - 44376191
Alignment:
| Q |
74 |
ttcaagttcaagttcaaatggaagaaactccattctttcatatgaacagccttcatcatcgt---cgtcatcatcgccttcattcttgaaccgctttcgt |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
44376295 |
ttcaagttcaagttcaaatggaagaaactccattctttcatatgaacagccttcatcatcgtcgtcgtcatcatcgccttcattcttgaaccgctttcgt |
44376196 |
T |
|
| Q |
171 |
tctgg |
175 |
Q |
| |
|
||||| |
|
|
| T |
44376195 |
tctgg |
44376191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 8 - 39
Target Start/End: Complemental strand, 44376352 - 44376321
Alignment:
| Q |
8 |
attgagttcctctacttgtttagcttggtttg |
39 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
44376352 |
attgagttcctctacttgtttagcttggtttg |
44376321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University