View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5713-Insertion-9 (Length: 295)
Name: NF5713-Insertion-9
Description: NF5713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5713-Insertion-9 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 7 - 295
Target Start/End: Complemental strand, 32992268 - 32991972
Alignment:
| Q |
7 |
attcaaaccaattcaatctggttc----aaacaaactgaagatcaaacaaactagtgaaccggttggttctcggctaaaccggtttaattgaccggttcg |
102 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32992268 |
attcaaaccaattcaatctggttcgttcaaccaaactgaagatcaaaccaactagtgaaccggttggttctcggctaaaccggtttaattgaccggttcg |
32992169 |
T |
|
| Q |
103 |
tttcagnnnnnnnaaaacattgaagtaaatcccctcacaggccacaaatgtaaacaaattgttcatgagaaatagtagaagaaaaattgaccaagatata |
202 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32992168 |
tttcagttttttttaaacattgaagtaaatcccctcacaggccacaaatgtaaacaaactgttcataagaaatagtagaagaaaaattgaccaagatata |
32992069 |
T |
|
| Q |
203 |
t----nnnnnnnntgaagatcaaagaaaataacatgctagctaaattcagctaatcaacagataaatttttgccatatagaaaatactcactctctc |
295 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32992068 |
taaaaaaaaaaaatgaagatcaaagaaaataacatgctagctaaattcagctaatcaacagataaattcttgccatatagaaaatactcactctctc |
32991972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University