View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5713_high_5 (Length: 229)
Name: NF5713_high_5
Description: NF5713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5713_high_5 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 53741175 - 53740941
Alignment:
| Q |
1 |
ttctgaagtaccaatgtttttataacaactttcaaatatttatattgaaaataattcaaaataaatgattgacgattcatttgagtat--gatagcatgg |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| | |||||||| |
|
|
| T |
53741175 |
ttctgaagtaccaatgtttttataacaactttcaaatatttat-ttgaaaataattcaaaataaatgattgacgattcatttgggtatatggtagcatgg |
53741077 |
T |
 |
| Q |
99 |
taacttaataatattcccact-----aacaatctcatgttcaaaatgttttcttgttggaagtgaacagagaaatgaattggtttgcgggcattgcctga |
193 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
53741076 |
taacttaatcatattcccacttcgctaacaatctcatgttcaaaatgttttcttgttggaagtgaacagagaaatgaattggtttgccggcattgcctga |
53740977 |
T |
 |
| Q |
194 |
aagaaattttattccattcttatatatactgtgatc |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
53740976 |
aagaaattttattccattcttatatatactgtgatc |
53740941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University