View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5714_high_11 (Length: 237)
Name: NF5714_high_11
Description: NF5714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5714_high_11 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 124; Significance: 6e-64; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 9 - 136
Target Start/End: Original strand, 24334275 - 24334402
Alignment:
| Q |
9 |
gcataggttatcaaagagtatatttcccactgctattctggaaattgttgagtcagcttacaaattgaaaataagctgagttatacacatggattctaca |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24334275 |
gcataggttatcaaagagtatatttcccactgctaatctggaaattgttgagtcagcttacaaattgaaaataagctgagttatacacatggattctaca |
24334374 |
T |
 |
| Q |
109 |
agctgaaaataagctactaattcataat |
136 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
24334375 |
agctgaaaataagctactaattcataat |
24334402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 173 - 221
Target Start/End: Original strand, 24334496 - 24334544
Alignment:
| Q |
173 |
gttagctgcaaggttttaaaaactggtccgcaacggtaattgtggttgt |
221 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
24334496 |
gttagctgcaaggttttaaaaaatggtccgcaaccataattgtggttgt |
24334544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University