View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5714_low_4 (Length: 325)
Name: NF5714_low_4
Description: NF5714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5714_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 1 - 294
Target Start/End: Original strand, 38336877 - 38337169
Alignment:
| Q |
1 |
tcatcaccaccccacctcatattttctaaccacgacccacccatccaaccttttcgtcaccgttcggcttgagatctggcgtggtggtggtggtttagat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
38336877 |
tcatcaccaccccacctcatattttctaaccacgacccacccatccaactttttcgtcaccatttggcttgagatctggcgtggtggtggtggtttagat |
38336976 |
T |
 |
| Q |
101 |
atggcgtgctctgcctaagatctcactggccatggcgttgtcaggtctagattccttctttggcatcagtggttgtagaggacgacgtggtggttctcca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
38336977 |
ctggcgtgctctgcctaagatctcactggccatggcgttgtcgggtctag-ttccttctttggcagcagtggttgtagagcacgacgtggtggttctcca |
38337075 |
T |
 |
| Q |
201 |
tggttgtggacagagaagtgtaaaaagattacggagttgacatagagagaacgagaaggaaaggatggagatgatgatgaagggtgggcagagg |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
38337076 |
tggttgtggacagagaagtgtaaaaagattacggagttgacttagagagaacgagaaggaaaggatggagatgatgatgaagggcgggcggagg |
38337169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University