View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5714_low_6 (Length: 285)
Name: NF5714_low_6
Description: NF5714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5714_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 119; Significance: 8e-61; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 119; E-Value: 8e-61
Query Start/End: Original strand, 120 - 266
Target Start/End: Complemental strand, 35586170 - 35586024
Alignment:
| Q |
120 |
gttgtagtatattgcttctccagtgaagggtgtcttctacattttcgaagagtttagtcctctttatcccgaagaccctatctcgtcgcctgatctccca |
219 |
Q |
| |
|
|||| ||||||||| |||||| || |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35586170 |
gttgcagtatattgattctccggtaaagggtgtcttctacatttttgaagagtttagtcctctttatcccgaagaccctatctcgtcgcctgatctccca |
35586071 |
T |
 |
| Q |
220 |
tccatctctcatctaaaagtagtcgtgcgtgatgaggagctagatcg |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
35586070 |
tccatctctcatctaaaagtagtcgtgcgtgatgagaagccagatcg |
35586024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 35586293 - 35586202
Alignment:
| Q |
1 |
actctgaaggaatctcgtttagaatatgactcatcgtcaaattcgactgaaaatgtacacctttgtg-ctttttttcttcacatacttcatc |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35586293 |
actctgaaggaatctcgtttagaatatgactcgtcatcaaattcgactgaaaatgtacacctttgtgtttttttttcttcacatacttcatc |
35586202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University