View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5715_high_14 (Length: 239)
Name: NF5715_high_14
Description: NF5715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5715_high_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 19 - 224
Target Start/End: Complemental strand, 10688744 - 10688550
Alignment:
| Q |
19 |
ggtattgtatccgtacctatgcatcctaaggtaagagcatgtcgtccacatttgaataattaacttgctagatttgagtgcgaccggtgtcgttgttgaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
10688744 |
ggtattgtatccgtacctatgcatcctaaggtaagagcatgtcgtccacatttgaataattaacttgcgagatttgagtgcgaccggcgtcgttgttgaa |
10688645 |
T |
|
| Q |
119 |
cttttggagacagcccattagggttctctagaaaggagaactgaactttactttggtggacttgaactgtgtttggttatggttaatcatatttctcgtt |
218 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10688644 |
cttttggagacagccc-----------ctagaaaggagaactgaactttactttggtggacttgaactgtgtttggttatggttaatcatatttctcgtt |
10688556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University