View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5716_low_6 (Length: 242)
Name: NF5716_low_6
Description: NF5716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5716_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 16 - 225
Target Start/End: Complemental strand, 19253276 - 19253067
Alignment:
| Q |
16 |
atgacaattgtttgaatcctatgttaaggtatataaataatccacaccataccctccataaaaatccacatataaattccatgactcttttgatgagatt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19253276 |
atgacaattgtttgaatcctatgttaaggtatataaataatccacaccgtaccctccataaaaatccacatataaattccatgactcttttgatgagatt |
19253177 |
T |
|
| Q |
116 |
gaaagatgtgtacttgatttgtgactacatatccaaaaccctaaaattaattgacctagnnnnnnntttctttacacatcttcatgtgtctcttgctttg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
19253176 |
gaaagatgtgtacttgatttgtgactacatatccaaaaccctaaaattaattgacctagccccccctttctttacacatcttcatgtgtctcttgctttg |
19253077 |
T |
|
| Q |
216 |
cattaatact |
225 |
Q |
| |
|
|||||||||| |
|
|
| T |
19253076 |
cattaatact |
19253067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University