View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5717-Insertion-8 (Length: 69)
Name: NF5717-Insertion-8
Description: NF5717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5717-Insertion-8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 39; Significance: 0.00000000000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.00000000000008
Query Start/End: Original strand, 8 - 50
Target Start/End: Complemental strand, 33142189 - 33142147
Alignment:
| Q |
8 |
ttttcttccttacttcaaaacgaaatccgatagttatcattca |
50 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33142189 |
tttttttccttacttcaaaacgaaatccgatagttatcattca |
33142147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.00000000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.00000000000008
Query Start/End: Original strand, 8 - 50
Target Start/End: Original strand, 33040428 - 33040470
Alignment:
| Q |
8 |
ttttcttccttacttcaaaacgaaatccgatagttatcattca |
50 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33040428 |
tttttttccttacttcaaaacgaaatccgatagttatcattca |
33040470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000002
Query Start/End: Original strand, 8 - 50
Target Start/End: Complemental strand, 42900321 - 42900279
Alignment:
| Q |
8 |
ttttcttccttacttcaaaacgaaatccgatagttatcattca |
50 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42900321 |
tttttttccttacttcagaacgaaatccgatagttatcattca |
42900279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University