View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5717_high_104 (Length: 243)
Name: NF5717_high_104
Description: NF5717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5717_high_104 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 128 - 219
Target Start/End: Original strand, 13462716 - 13462807
Alignment:
| Q |
128 |
ctatctgcacgacacccacgaggcttagctccagttatcatcccatacgaacattatctgcacctataattttgaatgagacgtgtgtttaa |
219 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
13462716 |
ctatctgcacgagacccacgaggcttagctccagttatcatcccatatgaacattatctgcaccattaattttgaatgagacgtgtgtttaa |
13462807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 18 - 83
Target Start/End: Original strand, 13462605 - 13462673
Alignment:
| Q |
18 |
tctatccctccctgagtgt--gagtgcatctcttttcaagttcaaccatagttt-ggtttatagaaata |
83 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
13462605 |
tctatccctccctgagtgtgtgagtgcatctcttttcaagttcaaccatagtttcgttttatagaaata |
13462673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University