View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5717_high_122 (Length: 227)
Name: NF5717_high_122
Description: NF5717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5717_high_122 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 58; Significance: 1e-24; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 41 - 106
Target Start/End: Complemental strand, 35846164 - 35846099
Alignment:
| Q |
41 |
tatgataatattattgtttgtttttacaagtgataatattattggttttaaattgaacttcttatt |
106 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35846164 |
tatgattatattattatttgtttttacaagtgataatattattggttttaaattgaacttcttatt |
35846099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 105 - 151
Target Start/End: Complemental strand, 35846061 - 35846015
Alignment:
| Q |
105 |
ttcaaaggtttgtgttagacaaaccctcatattagagtgtcaaaata |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35846061 |
ttcaaaggtttgtgttagacaaaccctcatattagagtgtcaaaata |
35846015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 177 - 227
Target Start/End: Complemental strand, 35845989 - 35845939
Alignment:
| Q |
177 |
agatggcaaaatattattaaatcatggtaataaaaattagtacaaacaata |
227 |
Q |
| |
|
|||||| ||||||||||||||||||| |||| |||| |||||||||||||| |
|
|
| T |
35845989 |
agatggaaaaatattattaaatcatgctaatgaaaagtagtacaaacaata |
35845939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 7 - 35
Target Start/End: Complemental strand, 35846219 - 35846191
Alignment:
| Q |
7 |
tctcatatatatgcaaattttttctttaa |
35 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
35846219 |
tctcatatatatgcaaattttttctttaa |
35846191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University