View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5717_high_24 (Length: 476)
Name: NF5717_high_24
Description: NF5717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5717_high_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 418; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 418; E-Value: 0
Query Start/End: Original strand, 10 - 462
Target Start/End: Complemental strand, 2304688 - 2304238
Alignment:
| Q |
10 |
atggtaaactaaagctggctaaagtttcaattctggttaaaagaaatactcatattaaagataaacgttaaatatgtgacatgtccacacaaaaataaaa |
109 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2304688 |
atggtaaactaaagctggctaaagtttaaattctggttaaaagaaatactcatattaaagataaacgttaaatatgtgacatgtccacacaaaaacaaaa |
2304589 |
T |
 |
| Q |
110 |
tcttctatatggttctgtatttcatggctttggtgataggagcatggacttatttcttcattgcaattatgtcagttgcagcatcaaaatcatcaccact |
209 |
Q |
| |
|
|||||||| |||||||| ||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2304588 |
tcttctat--ggttctgtctttaatggctttggtgataggagcatggacatatttcttcattgcaattatgtcagttgcagcatcaaaatcatcaccact |
2304491 |
T |
 |
| Q |
210 |
acaactagagaaagaagcacaagctcttgttaacagtgcttggtggaatgacttcaccaaccatgctccaactcgttgtcaatggccaggtataacatgc |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2304490 |
acaactagagaaagaagcacaagctcttgttaacagtggttggtggaatgacttcaccaaccatgctccaactcgttgtcaatggccaggtataacatgc |
2304391 |
T |
 |
| Q |
310 |
aacaatgaaggaagcattacaaacatttcattgccacctgaaattcaattaggagacaagtttggtaaattccatttctcatctttcacaaaccttgttc |
409 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2304390 |
aacaatgaaggaagcattacaaacatttcattgccacctgaaattcaattaggagacaagtttggtaaattccatttctcatctttcacaaaccttgttc |
2304291 |
T |
 |
| Q |
410 |
accttaatttagcttcacatggaatcattggtaacattccatttgaactagct |
462 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2304290 |
accttaatttagcttcacatggaatcattggtaacattccatttgaactagct |
2304238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University