View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5717_high_43 (Length: 363)
Name: NF5717_high_43
Description: NF5717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5717_high_43 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 4e-91; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 4e-91
Query Start/End: Original strand, 18 - 203
Target Start/End: Complemental strand, 41028077 - 41027892
Alignment:
| Q |
18 |
gttttgagtttttgagctatagcaagaaatgcatacaaggtaaagtgataaaaatagcttgtttgattgatcatatgtatctattaaagtgtatgccctt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41028077 |
gttttgagtttttgagctatagcaagaaatgcatacaaggtaaagtgataaaaatagtttgtttgattgatcatatgtatctattaaagtgtatgccctt |
41027978 |
T |
 |
| Q |
118 |
ggtatttataacagaaaccatgcatattagccaaacgacatggcctgacgtgacgaacccttgttcgactaatttcaagggttatg |
203 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
41027977 |
ggtatttataccagaaaccatgcatattagccaaacgacatgacctgacgtgacgaacccttgctcgactaatttcaagggttatg |
41027892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 206 - 341
Target Start/End: Complemental strand, 41027833 - 41027698
Alignment:
| Q |
206 |
agttggcaagttctatagtgcacatgtcagtgaagatcacatctcttcctttattcctcaaagtggttagtggcgttacaaacaaggaaagtgaattttt |
305 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
41027833 |
agttggcagggtctatagtgcacatgtcagtgaagatcacatctcttcctttattcctcaaagtggttagtggtgttacaaacaaggaaagtgaattttt |
41027734 |
T |
 |
| Q |
306 |
tgtgtcattgtcaggtcctactttgttttgactcaa |
341 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |
|
|
| T |
41027733 |
tgtgtcattgtcaagtcctactttgttttgactcaa |
41027698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 247 - 314
Target Start/End: Complemental strand, 23163805 - 23163738
Alignment:
| Q |
247 |
tctcttcctttattcctcaaagtggttagtggcgttacaaacaaggaaagtgaattttttgtgtcatt |
314 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||| |||| ||| |||||| |||| ||| | |||||||| |
|
|
| T |
23163805 |
tctcttccattattcctcaaagtggttaatggtgttataaataaggaacgtgagtttctcgtgtcatt |
23163738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University