View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5717_high_51 (Length: 340)
Name: NF5717_high_51
Description: NF5717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5717_high_51 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 9e-98; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 9e-98
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 25550281 - 25550081
Alignment:
| Q |
1 |
ttgtttaaaaatgacaatgacaatgacaatatccatcgatttgaagcttatgtgcaacgattgttggatgcggatgatccactttccagtaaccctcttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25550281 |
ttgtttaaaaatgacaatgacaatgacaatgtccatcgatttgaagcttatgtgcatcaattgttggatgcggatgatccactttccagtaaccctcttt |
25550182 |
T |
|
| Q |
101 |
ctgttggaaacaatgacaatgtccatccacctctcctcccaatcaaagctttctctaaaaatgacatttgtccttggaagaccattaagttagatacata |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
25550181 |
atgttggaaacaatgacaatgtccatccacctctcctcccaatcaaagctttctctaaaaatgacatttgtcctcggaagaccattaagttagatacata |
25550082 |
T |
|
| Q |
201 |
t |
201 |
Q |
| |
|
| |
|
|
| T |
25550081 |
t |
25550081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 280 - 322
Target Start/End: Complemental strand, 25550001 - 25549959
Alignment:
| Q |
280 |
gtctaaaatgttagaatatatacgatgtggttgttgacaattt |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25550001 |
gtctaaaatgttagaatatatacgatgtggttgttgacaattt |
25549959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University