View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5717_high_66 (Length: 299)
Name: NF5717_high_66
Description: NF5717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5717_high_66 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 1 - 282
Target Start/End: Complemental strand, 39850 - 39566
Alignment:
| Q |
1 |
tcaacatcaacatcaacatcaacggtggtgtctctatctcttccataacctatcctcaagccagatcgttttctccttctctgatgttggtgtgaagaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39850 |
tcaacatcaacatcaacatcaacggtggtgtctctatctcttccataacctatcctcaagccagatcgttttctccttctctgatgttggtgcgaagaag |
39751 |
T |
 |
| Q |
101 |
aagattgagattgagattgaagaagatcatggtcgttttgaatcggatcaacaacgacgagggtgaggtcagagaagatattctcgtcaaggggctgaga |
200 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39750 |
aagattgaga------ttgaagaagatcatggtcgttttgaatcggatcaacgacgacgagggtgaggtcagagaagatattctcgtcaaggggctgaga |
39657 |
T |
 |
| Q |
201 |
acacgaagc---------tgctgcagcagcaggagcatcatcactttgattgagttgttgattctcctcttccttttccttccccgttggt |
282 |
Q |
| |
|
|||| |||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39656 |
acacaaagctgatgatgatgatgcagcagcaggagcatcatcactttgattgagttgttgattctcctcttccttttccttccccgctggt |
39566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University