View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5717_high_67 (Length: 298)
Name: NF5717_high_67
Description: NF5717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5717_high_67 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 15 - 282
Target Start/End: Original strand, 41406600 - 41406867
Alignment:
| Q |
15 |
gagcatgcgaaatctaatgagcatcgcaatatacgcgaagttcatagagacaatacgtcgaacaccttgtctcattgaaacccatctctgttttaaattc |
114 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
41406600 |
gagcatgcgaaaactaatgagcatcgcaatatacgcgaagttcatagagacaatacgtcgaacaccttctgtcattgaaacccatctctgttttaaattc |
41406699 |
T |
|
| Q |
115 |
ttttgcacacaaacaactcaaaaccaagatagcttgtgtaagagaatcgaaaagcttcccaaaggagaatccatagcctccgcatttcgtagttggatgc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41406700 |
ttttgcacacaaacaactcaaaaccaagatagcttgtgtaagagaatcgaaaagcttcccaaaggagaatccatagcctccgcatttcgtagttggatgc |
41406799 |
T |
|
| Q |
215 |
gtgatgggttccccgttcgcggcgccgatgtctttcataccattaaccgtctcagaaagcttaacttc |
282 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41406800 |
gtgatggcttccccgttcgcggcgccgatgtctttcataccattaaccgtctcagaaagcttaacttc |
41406867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University