View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5717_high_71 (Length: 288)
Name: NF5717_high_71
Description: NF5717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5717_high_71 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 14 - 270
Target Start/End: Original strand, 4355101 - 4355358
Alignment:
| Q |
14 |
gaaagtgtcttattgatatcttaatcgcaacttacacacacaagtagccttgtaaaggtttgggatttttcagaaatattagtaggtttgacctcatcgt |
113 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4355101 |
gaaagtgtctgattgatatcttaatcgcaact-acacacacaagtagccttgtaaaggtttgggatttttcagaaatattagtaggtttgacctcatcgt |
4355199 |
T |
 |
| Q |
114 |
tttgccgtcattttttgaacaagaattggtatcgccacaatcagggtcacccccgcaatcaaagttaaaaaatggccacttggattagtgttcacataac |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4355200 |
tttgccgtcattttttgaacaagaattggtaccaccacaatcagtgtcacacccgcaatcaaagttaaaaaatggccacttggattagtgttcacataac |
4355299 |
T |
 |
| Q |
214 |
aactaa--aaatacatccaaccctctaaagacccgatacttcaaaatggatgacgtatc |
270 |
Q |
| |
|
|||||| | |||||||||||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
4355300 |
aactaaagatatacatccaaccctctgaagcctcgatacttcaaaatggatgacgtatc |
4355358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 234 - 270
Target Start/End: Complemental strand, 1043192 - 1043156
Alignment:
| Q |
234 |
ctctaaagacccgatacttcaaaatggatgacgtatc |
270 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
1043192 |
ctctgaagccccgatacttcaaaatggatgacgtatc |
1043156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University