View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5717_high_73 (Length: 283)
Name: NF5717_high_73
Description: NF5717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5717_high_73 |
 |  |
|
| [»] scaffold0147 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0147 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: scaffold0147
Description:
Target: scaffold0147; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 1 - 262
Target Start/End: Original strand, 17546 - 17807
Alignment:
| Q |
1 |
acaatttctgctctttctttttcaattgaaaaaccttttagctataagaatggtagatgagagcaatgatatgctcaccatgtctgccgagctcctggag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17546 |
acaatttctgctctttctttttcaattgaaaaaccttttagctataagaatggtagatgagagcaatgatatgctcaccatgtctgccgagctcctggag |
17645 |
T |
 |
| Q |
101 |
ctgtagctaaaatcaaaagagcggccagtaggtccacaggaaactgcaattggcaaaatgctctctggagggacaatatgaccacaagaaaagaaatgca |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17646 |
ctgtagctaaaatcaaaagagcgaccagtaggtccacaggaaactgcaattggcaaaatgctctctggagggacaatatgaccacaagaaaagaaatgca |
17745 |
T |
 |
| Q |
201 |
acttatttggtggtaaccatggaaagagtctctcccttgtctcttctattggctgaagtgtt |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17746 |
acttatttggtggtaaccatggaaagagtctctcccttgtctcttctattggctgaagtgtt |
17807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University