View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5717_high_78 (Length: 266)
Name: NF5717_high_78
Description: NF5717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5717_high_78 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 225; Significance: 1e-124; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 18 - 258
Target Start/End: Original strand, 30231601 - 30231841
Alignment:
| Q |
18 |
tatgatgctgattattcttgttaattaaatctatgttgcagacttgcagtgcatgcatactgtgattctggttaatttctctggctaaatagttttgatg |
117 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30231601 |
tatgatgctgattattcttgtgaataaaatctatgttgcagacttgcagtgcatgcatactgtgattctggttaatttctctggctaaatagttttgatg |
30231700 |
T |
|
| Q |
118 |
ctatctctgattatattttaatgattattcttgtgaacaaagtgtatgtgatagtctagagtatgattttgatgctcatgacagttgttatgatcacaat |
217 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30231701 |
ctatctctgattatgttttaatgattattcttgtgaacaaagtgtatgtgatagtctagagtatgattttgatgctgatgacagttgttatgatcacaat |
30231800 |
T |
|
| Q |
218 |
tattcttttcaacgttgtttatgtatgacaatctagagtat |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30231801 |
tattcttttcaacgttgtttatgtatgacaatctagagtat |
30231841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 162 - 217
Target Start/End: Original strand, 30224780 - 30224835
Alignment:
| Q |
162 |
tatgtgatagtctagagtatgattttgatgctcatgacagttgttatgatcacaat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
30224780 |
tatgtgatagtctagagtatgattttgatgctgataacagttgttatgatcacaat |
30224835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 18 - 118
Target Start/End: Original strand, 30224678 - 30224775
Alignment:
| Q |
18 |
tatgatgctgattattcttgttaattaaatctatgttgcagacttgcagtgcat-gcatactgtgattctggttaatttctctggctaaatagttttgat |
116 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||||| |||| |||| ||| | ||||||| |||||||| ||| ||||||| |||||||||||||||| |
|
|
| T |
30224678 |
tatgattctgattattcttgttaataaaatctatgtggcag---tgca-tgcgttgcatactatgattctgattattttctcttgctaaatagttttgat |
30224773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University