View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5717_high_80 (Length: 262)
Name: NF5717_high_80
Description: NF5717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5717_high_80 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 56 - 246
Target Start/End: Original strand, 47622427 - 47622617
Alignment:
| Q |
56 |
ttaatttcatctcctttcttgtaagtaacctggtttggttattccaacccaggtagttctttagtttgcttgagcctccatggggcgttagaacggttta |
155 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
47622427 |
ttaatttcatctcctttcttgtaggtaacctggtttggttattccaacccaggtagttctttagtttgcttgagcctccatggggagttagaacggttta |
47622526 |
T |
 |
| Q |
156 |
aaacaacacctcgccatcaaaccaagaagctaacatcnnnnnnncggggtacaggaaaatccttcttgtctcacaaattataacaatttgt |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
47622527 |
aaacaacacctcgccatcaaaccaagaagctaacatctttttttcggggtacaggaaaatccttcttgtctcgcaaattataacaatttgt |
47622617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University