View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5717_high_86 (Length: 251)
Name: NF5717_high_86
Description: NF5717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5717_high_86 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 17 - 251
Target Start/End: Original strand, 28277846 - 28278081
Alignment:
| Q |
17 |
tgcaggaaatattaagagttcagtttgtggattgtgcaaacaattgtgaatcctgacaaccatgcatggattgtgcaagcaaggtgagatgatagacgga |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
28277846 |
tgcaggaaatattaagagttcagtttgtggattgtgcaaacaactgtgaatcgtgacaaccatgcatggatcgtgcaagcaaggtgagatgatagacgga |
28277945 |
T |
|
| Q |
117 |
tatggtttcgtggccaaggcagggtgagtacggttcctccagagccaccaagtgcttgcaacgaacaaatttttataatattttaaaatgagttgatact |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28277946 |
tatggtttcgtggccaaggcagggtgagtacggttcctccagggccaccaagtgcttgcaacgaacaaatttttataatattttaaaatgagttgatact |
28278045 |
T |
|
| Q |
217 |
ttttcaaataacttcaattg-agttaccatattttt |
251 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28278046 |
ttttcaaataacttcaattgaagttaccatattttt |
28278081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University