View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5717_high_90 (Length: 251)
Name: NF5717_high_90
Description: NF5717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5717_high_90 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 20868522 - 20868327
Alignment:
| Q |
1 |
gaagtggttctttgaatgagctggctggtgttgaaagatttcttgtggccttggatgaactgagatattcaagatttgaattatcaaacctgaagcaggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
20868522 |
gaagtggttctttgaatgagctggctggtgttgaaagatttcttgtggccttggatgaactgagatattcaagatttgaattgtcaaacctgaagcaggt |
20868423 |
T |
|
| Q |
101 |
ataagaagttctttctctatgtgcaatgcaatttgaaaacttgttgatttatgtctttggtta-tccattattgaatttgaaggattggctagataaat |
198 |
Q |
| |
|
|||| ||| ||||||| |||||| |||||||| ||||||||| || |||| ||||||||| ||| |||| ||||||||| |||||||||||||| |
|
|
| T |
20868422 |
ataacaagctctttctttatgtgtgatgcaattgaaaaacttgtcgagttatctctttggtttgtcctttat---atttgaagggttggctagataaat |
20868327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 33 - 111
Target Start/End: Complemental strand, 40987792 - 40987714
Alignment:
| Q |
33 |
gaaagatttcttgtggccttggatgaactgagatattcaagatttgaattatcaaacctgaagcaggtataagaagttc |
111 |
Q |
| |
|
||||| ||||| ||||||||||||||||| ||| || |||||||||| ||| ||||| |||||||||||||||||| |
|
|
| T |
40987792 |
gaaaggtttctggtggccttggatgaacttggattatcgggatttgaattgtcagacctggagcaggtataagaagttc |
40987714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University