View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5717_high_95 (Length: 250)
Name: NF5717_high_95
Description: NF5717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5717_high_95 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 47150661 - 47150863
Alignment:
| Q |
1 |
cgccctctatagctagcatttccaatttcatttgtctcaataaagagaagcattatgcttttatggagcatttcatttcacaaatgaattgaagtaatag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47150661 |
cgccctctatagctagcatttccaatttcatttgtctcaataaagagaagcattatgcttttatggagcatttcatttcacaaatgaattgaagtaatag |
47150760 |
T |
 |
| Q |
101 |
atctcatatatctaacatggctcaacaacactataacccaatattacttttggatacgttgtactgttcagaagaacattgggaggaacaggatgagtta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
47150761 |
atctcatatatctaacatggctcaacaacactataacccaatattacttttggatacgttgtactgttcagaagaacattgggaggaacaagatgagtta |
47150860 |
T |
 |
| Q |
201 |
gag |
203 |
Q |
| |
|
||| |
|
|
| T |
47150861 |
gag |
47150863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University