View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5717_low_108 (Length: 241)
Name: NF5717_low_108
Description: NF5717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5717_low_108 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 17 - 232
Target Start/End: Original strand, 47994171 - 47994386
Alignment:
| Q |
17 |
agaaaatgcattgaaggtttaggtcttaaccttattttattgagaggattaacatgctttaaaactttgggtcaattgatgaaatccaactttgataaaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47994171 |
agaaaatgcattgaaggtttaggtcttaaccttattttattgagaggattaacatgctttaaaactttgggtcaattgatgaaatccaactttgataaaa |
47994270 |
T |
 |
| Q |
117 |
gagtaatttgaatatacacagagttagaagtataacttgttatgatattttttcttcttccgagtttcatgcaagtcgtaccatgtatatgacttgacat |
216 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47994271 |
gagtaatttgaatatacacggagttagaagtataacttgttatgatattttttcttcttccgagtttcatgcaagtcgtaccatgtatatgacttgacat |
47994370 |
T |
 |
| Q |
217 |
gttttttcagaattat |
232 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
47994371 |
gttttttcagagttat |
47994386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University