View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5717_low_111 (Length: 239)
Name: NF5717_low_111
Description: NF5717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5717_low_111 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 17 - 235
Target Start/End: Complemental strand, 28278289 - 28278067
Alignment:
| Q |
17 |
atttatcatgatatagttatc------atatagatagagataatattgagtnnnnnnnngataaattaccaacaaaatttgttaggtaatgcagactcta |
110 |
Q |
| |
|
||||||||||||||||||||| ||||||| | |||||||||||||| ||||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
28278289 |
atttatcatgatatagttatctgcttaatatagacatagataatattgagtaaaaaaaagataaattacctacaaaatttgttagaaaatgcagactcta |
28278190 |
T |
|
| Q |
111 |
gtgctaactcacaactaaaatttttggacggtcaaaacttattcaaaacttttagacggatttaaaacaaaatttgagatatttataggaccaaaattta |
210 |
Q |
| |
|
||||||||||| ||||||| |||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| ||| |
|
|
| T |
28278189 |
gtgctaactca--actaaaacttttgggcggtcaaaacttattcaaaacttttagacagatttaaaacaaaatttgagatctttataggaccaaaactta |
28278092 |
T |
|
| Q |
211 |
ttttaccttaaaaaatatggtaact |
235 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
28278091 |
ttttaccttaaaaaatatggtaact |
28278067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University