View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5717_low_113 (Length: 239)
Name: NF5717_low_113
Description: NF5717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5717_low_113 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 100; Significance: 1e-49; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 38 - 149
Target Start/End: Original strand, 30231224 - 30231335
Alignment:
| Q |
38 |
ccatcaagtcagcacttagatcagcagttaggtcagcgtttaggacacatagaaaggaaatacatagtgcatttggggaagcacttggggatacatttat |
137 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
30231224 |
ccattaagtcagcacttagatcagcagttaggtcagcgtttaggacacatagaaaggaaatacatagtgcctttggggaagcatttggggatacatttat |
30231323 |
T |
|
| Q |
138 |
tcgttgaatgca |
149 |
Q |
| |
|
|||||||||||| |
|
|
| T |
30231324 |
tcgttgaatgca |
30231335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 58 - 134
Target Start/End: Original strand, 30224230 - 30224306
Alignment:
| Q |
58 |
tcagcagttaggtcagcgtttaggacacatagaaaggaaatacatagtgcatttggggaagcacttggggatacatt |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||| || |||||||| | ||||| ||||| |
|
|
| T |
30224230 |
tcagcagttaggtcagcgtttaggacacatggaaaggaaatacatagtgccttcagggaagcattaggggaaacatt |
30224306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 207 - 239
Target Start/End: Original strand, 30231393 - 30231425
Alignment:
| Q |
207 |
cagcataggatgaagccattggtcaatgtttcc |
239 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
30231393 |
cagcattggatgaagccattggtcaatgtttcc |
30231425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University