View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5717_low_114 (Length: 238)
Name: NF5717_low_114
Description: NF5717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5717_low_114 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 35136757 - 35136985
Alignment:
| Q |
1 |
gttgacggtagtttagttgagaaaatagatgggtgtaacaaggaatttttgtcacttagttcaaatttgtgtatcac-------atgaacgtggttttca |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
35136757 |
gttgacggtagtttagttgagaaaatagatgggtgtaacaaggaatttttgtcacttagttcaaatttgtgtatcacgattcacatgaacgtggttttca |
35136856 |
T |
 |
| Q |
94 |
cataccaccggtccaccaccacgtgaatacccttcccatcaacttcacaagttacgagggaaaataataccacaaaaagtgacatgccaaagagaattta |
193 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35136857 |
catacccccggtccaccaccacgtgaatacccttcctatcaacttcacaagttacgagggaaaataataccacaaaaagtgacatgccaaagagaattta |
35136956 |
T |
 |
| Q |
194 |
tataggttggtgatatatttagacatatc |
222 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
35136957 |
tataggttggtgatatatttagacatatc |
35136985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University