View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5717_low_125 (Length: 227)

Name: NF5717_low_125
Description: NF5717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5717_low_125
NF5717_low_125
[»] chr8 (4 HSPs)
chr8 (41-106)||(35846099-35846164)
chr8 (105-151)||(35846015-35846061)
chr8 (177-227)||(35845939-35845989)
chr8 (7-35)||(35846191-35846219)


Alignment Details
Target: chr8 (Bit Score: 58; Significance: 1e-24; HSPs: 4)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 41 - 106
Target Start/End: Complemental strand, 35846164 - 35846099
Alignment:
41 tatgataatattattgtttgtttttacaagtgataatattattggttttaaattgaacttcttatt 106  Q
    |||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
35846164 tatgattatattattatttgtttttacaagtgataatattattggttttaaattgaacttcttatt 35846099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 105 - 151
Target Start/End: Complemental strand, 35846061 - 35846015
Alignment:
105 ttcaaaggtttgtgttagacaaaccctcatattagagtgtcaaaata 151  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
35846061 ttcaaaggtttgtgttagacaaaccctcatattagagtgtcaaaata 35846015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 177 - 227
Target Start/End: Complemental strand, 35845989 - 35845939
Alignment:
177 agatggcaaaatattattaaatcatggtaataaaaattagtacaaacaata 227  Q
    |||||| ||||||||||||||||||| |||| |||| ||||||||||||||    
35845989 agatggaaaaatattattaaatcatgctaatgaaaagtagtacaaacaata 35845939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 7 - 35
Target Start/End: Complemental strand, 35846219 - 35846191
Alignment:
7 tctcatatatatgcaaattttttctttaa 35  Q
    |||||||||||||||||||||||||||||    
35846219 tctcatatatatgcaaattttttctttaa 35846191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University